Journal: Cancer research

Article Title: Spindle assembly checkpoint inhibition can resensitize p53-null stem cells to cancer chemotherapy

doi: 10.1158/0008-5472.CAN-18-3024

Figure Lengend Snippet: A, Gene rank ordered by negative selection score from MAGeCK output from Cisplatin treatment versus DMF. Red dots: significant genes between Cisplatin treatment and DMF control (p < 0.01) from MAGeCK analysis. Blue dots: genes involving in spindle assembly checkpoint and chromosome organization. B, Scatterplots of CRISPR gene scores of Cisplatin treated TP53-KO hESCs and DMF treated TP53-KO hESCs. Grey dot: all genes. Red dot: the 137 significant genes between Cisplatin treatment and DMF treatment from MAGeCK software. C, The position of 6 sgRNAs targeting gene ZNF207/BuGZ or BRD7 are showing in ordered rank of all library sgRNA counts. Red line: sgRNAs targeting the same gene. D, Top eight GO biological processes of GO analysis for 137 significant genes. E, Cas9-expressed TP53-KO human ESCs were infected with ZNF207/BuGZ sgRNAs or control OR1C1 sgRNAs. Then treated with DMF and Cisplatin, respectively. The ZNF207/BuGZ or OR1C1 knockout cells were monitored by qPCR. *, p < 0.05. Kaplan-Meier survival plot was generated from the cohort of ovarian cancer patients according to ZNF207 expression level (http://kmplot.com/analysis/). P values on the plots are from log-rank test for the comparisons of the low and high ZNF207 expression groups. F, All 449 patients are TP53-mutated and received chemotherapy that contained platin. G, All 82 patients are TP53-wt and received chemotherapy that contained platin.

Article Snippet: The stable Cas9-expressing TP53-KO hESCs were infected with viruses with two sgRNAs against gene ZNF207/BuGZ (#TEDH-1090944, TransOMIC) or control gene OR1C1 (#TEDH-1055091, TransOMIC).

Techniques: Selection, CRISPR, Software, Infection, Knock-Out, Generated, Expressing

Journal: Journal of the American Chemical Society

Article Title: Bridged Proteolysis Targeting Chimera (PROTAC) Enables Degradation of Undruggable Targets

doi: 10.1021/jacs.2c09255

Figure Lengend Snippet: MS28 effectively degrades cyclin D1 in a VHL-, CDK6-, and UPS-dependent manner. (A) Left, VHL KO rescues the MS28-induced degradation of cyclin D1 and CDK4/6. Calu-1 cells were transduced with lentivirus containing VHL-targeting sgRNA or an empty vector. Antibiotic-selected cells were checked for VHL expression (Top: WB results confirm CRISPR-mediated VHL KO in Calu-1 cells), followed by treatment with MS28 for 8 h. Right, quantification of cyclin D1 and CDK4/6 abundance in the indicated experimental groups. P-values for each protein were calculated between the mock and VHL KO groups (indicated by bar) within each concentration. (B) Left, CDK6 KD via siRNA rescues the MS28-induced degradation of cyclin D1. Calu-1 cells were transfected with CDK6-targeting siRNA for 2 days, followed by treatment with MS28 for 8 h. Right, quantification of cyclin D1 abundance in the indicated experimental groups. P-values were calculated between the control and CDK6 KD group within each MS28 concentration. (C) VHL coelutes with cyclin D1-CDK6 in the presence of MS28. His-tagged CDK6 was immobilized on cobalt agarose resin and incubated overnight along with cyclin D1. The VCB complex was added the next day with either DMSO or MS28. Pretreatment with MG132 (D) or MLN4924 (E) rescues the MS28-induced degradation of cyclin D1 and CDK4/6. Quantification of cyclin D1 and CDK4/6 abundance are listed aside. For each protein, p-values were calculated between groups indicated by the lines above the bars. Calu-1 cells were pretreated with MG132 or MLN4924 for 1 h, followed by treatment with MS28 for 8 h. WB results shown in panels A–E are representative of at least two independent experiments. ****P < 0.0001, ***P < 0.001, **P < 0.01, and *P < 0.05.

Article Snippet: The sgRNA sequence targeting human VHL gene was chosen from the CRISPR sgRNA database from GenScript ( https://www.genscript.com/gRNA-database.html ).

Techniques: Transduction, Plasmid Preparation, Expressing, CRISPR, Concentration Assay, Transfection, Control, Incubation

Journal: Journal of the American Chemical Society

Article Title: Bridged Proteolysis Targeting Chimera (PROTAC) Enables Degradation of Undruggable Targets

doi: 10.1021/jacs.2c09255

Figure Lengend Snippet: sgRNA Sequences Used in CRISPR/Cas9-Mediated KO Studies

Article Snippet: The sgRNA sequence targeting human VHL gene was chosen from the CRISPR sgRNA database from GenScript ( https://www.genscript.com/gRNA-database.html ).

Techniques: CRISPR, Sequencing

Journal: bioRxiv

Article Title: Translational response to mitochondrial stresses is orchestrated by tRNA modifications

doi: 10.1101/2024.02.14.580389

Figure Lengend Snippet: a: Schematic for the synthesis pathway of hm5C and f5C modifications and the responsible enzymes. b: Validation of ALKBH1 knockout (KO) in the two generated clones. c: Analysis of ALKBH1 expression after 8 hours of stress exposure. d: LCMS/MS analysis of tRNA modifications after ALKBH1 KO. Data is normalized to Mock. Asterisk indicates fold change > 1.5 and p < 0.05. e: Analysis of hm5C peaks showing the complete depletion of hm5C after ALKBH1 KO. f: Cell proliferation after ALKBH1 KO. g: Analysis of OXPHOS related proteins in all 5 complexes using western blot. h: Mitochondrial respiration analysis using Seahorse.

Article Snippet: Lentivirus CRISPR sgRNAs targeting ALKBH1 gene (F: CACCGGAAACCTAATGTATGTAACC), QTRT1 gene (F: GGAGTGGCCACTGTCCCATG), QTRT2 gene (F: GGGGCTGACTGGATCGTGCA), and a non-targeting control (F: GTTCCGCGTTACATAACTTA) were designed using the BROAD Institute CRISPick design tool.

Techniques: Biomarker Discovery, Knock-Out, Generated, Clone Assay, Expressing, Western Blot

Journal: Journal of Cellular and Molecular Medicine

Article Title: Sublytic C5b‐9 induces proliferation of glomerular mesangial cells via ERK5/MZF1/RGC‐32 axis activated by FBXO28‐TRAF6 complex

doi: 10.1111/jcmm.14473

Figure Lengend Snippet: The expression of FBXO28 and TRAF6 in the renal tissues of Thy‐1N rats and in the GMCs stimulated with sublytic C5b‐9. A and B, The protein levels of FBXO28 and TRAF6 in the renal tissues of Thy‐1N rats (A) and in the GMCs exposed to sublytic C5b‐9 (B) for different time‐points were examined using IB assay. * P < 0.05, ** P < 0.01 vs 0 hour time‐point. C‐E, The protein levels of FBXO28 and TRAF6 in the renal tissues of Thy‐1N and NRS rats at 5 hours were examined using IB analysis (C) and IHC staining (D and E, Magnification, ×400) respectively. ** P < 0.01 vs NRS groups. F, Rat GMCs were divided into different groups. At 5 hours after treatment, the protein levels of FBXO28 and TRAF6 were determined using IB experiments. ** P < 0.01 vs other groups. Results from one representative experiment out of three are shown. Data are represented as means ± SD (n = 6 in vivo, n = 3 in vitro in each group or each time‐point)

Article Snippet: Short guide RNAs (sgRNAs) targeting exon 1 of rat FBXO28 gene and TRAF6 gene were designed with CRISPR Design and constructed into pGK1.1 (Genloci Biotechnlogy, Nanjing, China).

Techniques: Expressing, Immunohistochemistry, In Vivo, In Vitro

Journal: Journal of Cellular and Molecular Medicine

Article Title: Sublytic C5b‐9 induces proliferation of glomerular mesangial cells via ERK5/MZF1/RGC‐32 axis activated by FBXO28‐TRAF6 complex

doi: 10.1111/jcmm.14473

Figure Lengend Snippet: FBXO28‐TRAF6 complex‐mediated ERK5 K63‐ubiquitination is necessary for ERK5/MZF1/RGC‐32 activation as well as GMC proliferative changes in response to sublytic C5b‐9. A and B, Rat GMCs were transfected with shFBXO28 (A) or shTRAF6 (B) for 48 hours followed by sublytic C5b‐9 treatment for different time‐points. The expression levels of FBXO28, TRAF6 and ERk5 at 5 hours, MZF‐1 and RGC‐32 at 10 hours, as well as cyclin D2, PCNA, FN and collagen IV at 18 hours were detected using IB. C and D, Co‐IP experiment was done to pull down ERK5 protein with anti‐ERK5 from FBXO28‐dificient GMCs (C) or TRAF6‐dificient GMCs (D) exposed to sublytic C5b‐9 for 5 hours, the then IB assay was used to detect K63‐ubiquitin, ERK5, FBXO28 and TRAF6 in the co‐IP‐complex as well as FBXO28, TRAF6, ERK5, p‐ERK5, MZF1 and RGC‐32 in WCE. E, TRAF6‐dificient GMCs was transfected with pcDNA3.1/HA‐TRAF6 WT or pcDNA3.1/HA‐TRAF6 C70A for 48 hours and then the levels of K63‐ubiquitin, ERK5 and HA‐TRAF6 in the co‐IP‐complex and HA‐TRAF6, ERK5 and p‐ERK5 in WCE were detected using IB analysis. F, 293T cells were transfected with pcDNA3.1/FBXO28‐His, pcDNA3.1/FBXO28∆1‐His or pcDNA3.1/FBXO28∆2‐His and pEGFP‐N1/ERK5‐Flag and pcDNA3.1/HA‐TRAF6. Co‐IP experiment was done to pull down FBXO28‐His, FBXO28∆1‐His or FBXO28∆2‐His protein with anti‐His, then IB assay was used to detect ERK5‐Flag, FBXO28‐His and HA‐TRAF6 in the co‐IP‐complex and WCE. Results from one representative experiment out of three are shown. Data are represented as means ± SD (n = 3 in each group)

Article Snippet: Short guide RNAs (sgRNAs) targeting exon 1 of rat FBXO28 gene and TRAF6 gene were designed with CRISPR Design and constructed into pGK1.1 (Genloci Biotechnlogy, Nanjing, China).

Techniques: Activation Assay, Transfection, Expressing, Co-Immunoprecipitation Assay

Journal: Journal of Cellular and Molecular Medicine

Article Title: Sublytic C5b‐9 induces proliferation of glomerular mesangial cells via ERK5/MZF1/RGC‐32 axis activated by FBXO28‐TRAF6 complex

doi: 10.1111/jcmm.14473

Figure Lengend Snippet: Knockdown of renal FBXO28, TRAF6, ERK5, MZF1 and RGC‐32 gene abolished GMC proliferation and ECM secretion in Thy‐1N rats. LV‐shFBXO28, LV‐shTRAF6, LV‐shERK5, LV‐shMZF1 and LV‐shRGC‐32 were used to silence target genes, and then Thy‐1N was induced 4 days later. A, The protein levels of FBXO28, TRAF6, p‐ERK5, t‐ERK5, MZF1, RGC‐32, cyclin D2, PCNA, FN and collagen IV in the renal tissues of rats were detected using IB assay (at 5 hours for FBXO28, TRAF6, p‐ERK5 and t‐ERK5, at 10 hours for MZF1 and RGC‐32, on 7 d for cyclin D2, PCNA, FN and collagen IV). B and C, The numbers of total glomerular cells in different groups of rats on 7 d after Thy‐1N induction was observed using Haematoxylin and eosin under LM (Magnification, ×400). D, GMC proliferation and ECM accumulation in different groups of rats on 7 d after Thy‐1N induction were evaluated by EM. E, The content of urinary protein (mg/24 h) of rats on day 7 after Thy‐1N induction was detected. F, A schematic drawing for the pathway we revealed. ** P < 0.01 vs Thy‐1N group and LV‐shCTR + Thy‐1N group. Results from one representative experiment out of three are shown. Data are represented as means ± SD (n = 6 in each group)

Article Snippet: Short guide RNAs (sgRNAs) targeting exon 1 of rat FBXO28 gene and TRAF6 gene were designed with CRISPR Design and constructed into pGK1.1 (Genloci Biotechnlogy, Nanjing, China).

Techniques: